Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14356H11
Clone ID IST14356H11
Vector VICTR74
Project tigm

Sequence tag IST14356H11HMF1
Sequence
CCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI12851 UNI30897 UNI30898 UNI30899 UNI30900 UNI30901

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166334: 5436..5474 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166291: 23716..23754 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166327: 26076..26114 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166282: 120138..120176 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166314: 3257..3295 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 76249..76287 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079800 (A530040E14Rik) RIKEN cDNA A530040E14 gene Gene [Source:MGI Symbol;Acc:MGI:3612703]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 32064..32102 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_162750: 15299..15337 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 104175..104213 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 132974..133012 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 333376..333414 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056050 (Mia3) NP_796363 melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 605476..605514 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069045 (Ddx3y) NM_012008 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene [Source:MGI Symbol;Acc:MGI:1349406]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3426918..3426956 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3404799..3404837 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3542119..3542157 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3553351..3553389 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3736770..3736808 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3414831..3414869 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3349381..3349419 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3100980..3101018 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4373064..4373102 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8600469..8600507 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058570 (AC129222.4-202) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TZ95]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3480888..3480926 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000766 (Oprm1) NM_001039652 opioid receptor, mu 1 Gene [Source:MGI (curated);Acc:Oprm1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3462316..3462354 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3660388..3660426 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023964 (Calcr) NM_001042725 calcitonin receptor Gene [Source:MGI Symbol;Acc:MGI:101950]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3185599..3185637 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3163681..3163719 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3073808..3073846 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3304382..3304420 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4273327..4273365 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3176223..3176261 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4793036..4793074 39
NO GENE  


Sequence tag IST14356H11BBF1
Sequence
CCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI12851 UNI30897 UNI30898 UNI30899 UNI30900 UNI30901

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166334: 5436..5474 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166291: 23716..23754 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166327: 26076..26114 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166282: 120138..120176 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166314: 3257..3295 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 76249..76287 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079800 (A530040E14Rik) RIKEN cDNA A530040E14 gene Gene [Source:MGI Symbol;Acc:MGI:3612703]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 32064..32102 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_162750: 15299..15337 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 104175..104213 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 132974..133012 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 333376..333414 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056050 (Mia3) NP_796363 melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 605476..605514 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069045 (Ddx3y) NM_012008 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene [Source:MGI Symbol;Acc:MGI:1349406]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3426918..3426956 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3404799..3404837 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3542119..3542157 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3553351..3553389 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3736770..3736808 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3414831..3414869 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3349381..3349419 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3100980..3101018 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4373064..4373102 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8600469..8600507 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058570 (AC129222.4-202) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TZ95]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3480888..3480926 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000766 (Oprm1) NM_001039652 opioid receptor, mu 1 Gene [Source:MGI (curated);Acc:Oprm1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3462316..3462354 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3660388..3660426 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023964 (Calcr) NM_001042725 calcitonin receptor Gene [Source:MGI Symbol;Acc:MGI:101950]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3185599..3185637 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3163681..3163719 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3073808..3073846 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3304382..3304420 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4273327..4273365 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3176223..3176261 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4793036..4793074 39
NO GENE  

 
Come back to gene ENSMUSG00000023964


For any suggestions or comments, please send an email to unitrap@crg.es