Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0187
Clone ID XS0187
Vector pGT0lxf
Project sanger

Sequence tag XS0187
Sequence
AGCCAACCCCACCCGCGCGTCCGTGCGGTCGCGGTCCCTATCCCGGACGCCGTCCGGCCCGAAGCGCTTGACCTGCCGGC
CCGCGGGGTTCCGGGCGCCGGGGAGCCGGGCCTGGGTTTCTTGGCCGCTGCGCTCGGCACCGCGCTTGGCAGAGCCAGAC
ATCAGAACACCCTAGAAGGCGTGGCTGAAAGGATGCTCATGTTTGATCCAGTCCCTGTCAAGCAGGAGGCCATGGACCCT
GTCTCGGTG
Sequence Type mRNA
Unitrap ID UNI2083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65194878..65208069 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es