Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579E5
Clone ID IST14579E5
Vector VICTR74
Project tigm

Sequence tag IST14579E5HMF1
Sequence
NTCNNNNNNGCCCANCTTTTTAAANAGNNNACTTCCTTTCNCCANCAGAATTCCAAAGAAGCAGTGACNAGAGCTGTCTT
ANTTAGGGTTTCATTGCTGTGAANANACACCATGATCAAGGTAACTCTCATAAATGAAACCATTTAACAGAGGCTGGCTT
ACAGTTTCANAGGTTTAGTCATTATGGCAGAAAACATGGCGGCATGCACGCANACATGGTGCTGGAGGACACAAGAATTC
TACATACGGATCCGAAGGCAGCCAGGAGGAGGCTCTCTCCTGCACTGCATTGAGCTTGAGCACTAGGAGCCCACAAAGCC
CACCTGCACAGTGACACACTTCCTCCAACAAGGCCACGCCCATTCCAACAAGGCCACACTCCTAATGGTGCCACTCCCAA
TGGGCCANACATACCCNAANCNATGGCATGAGCNNNNNNACATCCANGAANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14579E5HMR1
Sequence
TGGCTCANTGGACAAAGAGGCTTGCTGCCAAAGCTGATGACCTGGGTTTGATCCCCAGGACCTCTATGGTGGAAGGCAAG
AACTAACTCGTGCAAGTTGTCTCCTGGCCTCCACACACTATTTAACAATCAGAACAGAGAGCTGACAAGATGGCTCANCA
NAGCACATGCTGCCCTTCCAGGGGGCCCAAGTTCANTTCCAAGCATCAAAACACCCAGGCCTCACTCTCCCCATCTAGCG
CGCGCGCNCACGCACACACACACACACACACACACACACACACNCN
Sequence Type genomic DNA
Unitrap ID UNI1307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46747869..46748151 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023972 (Ptk7) NM_175168 PTK7 protein tyrosine kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1918711]


Sequence tag IST14579E5BBF1
Sequence
ATCTCATCGGCCCAGCTTTTTAAATAGCTTACTTCCTTTCTCCAGCAGAATTCCAAAGAAGCAGTGACGAGAGCTGTCTT
AGTTAGGGTTTCATTGCTGTGAAGAGACACCATGATCAAGGTAACTCTCATAAATGAAACCATTTAACAGAGGCTGGCTT
ACAGTTTCAGAGGTTTAGTCATTATGGCAGAAAACATGGCGGCATGCACGCAGACATGGTGCTGGAGGACACAAGAATTC
TACATACGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46748151..46748402 252
 
EST/CDNA Est Name
  BY304035.1 - BB639966.1 - BI686657.1 - BQ960410.1

 
Come back to gene BY304035.1 - BB639966.1 - BI686657.1 - BQ960410.1


For any suggestions or comments, please send an email to unitrap@crg.es