Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12232B12
Clone ID IST12232B12
Vector VICTR76
Project tigm

Sequence tag IST12232B12BBF1
Sequence
GAGAGGGCTAGGAGGGCCTGGCTCAGCGGCACTCAGGCCTGCCTGCCTGCCTTTTGTCGGGGGGTGGCAGGGGTTGAGGG
TGGGGGACTCAGCTGTATGGAATTTAGAACAGGATTCTCTCTGGGCTTGGGAAAATCCACAGAAGGGAAAAGTAGAGAAG
CAGCCTCCTTCCTAATCAATAAGCAAACAAGTCGTGGAGTCGCCCAAACAGCCACAGGAATGCTCCGTGGGCTGTAGCCA
GTGGCAGTGCCAGAGAGCACCCCTGTATTTAGGCAGTAGGGTGCGGTGGTATTGTCTGCTTGCAGCTAAAAGCCAGGACA
CCACAGCCCTGACTTGGCATGAAAGCCAAAGGTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109164786..109165147 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]


Sequence tag IST12232B12HMF2
Sequence
CTCTNAAACAAAAAGTTTATCTGAACTGANATCTAANTAATTTGCTGCAACTTCTTAATGTATCATTACTTACATGTTTT
TAAATCANTGGTTTATTTGTTACAGTTTAANAGTTAATCTTANCCAGGCGTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es