Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11322H9
Clone ID IST11322H9
Vector VICTR76
Project tigm

Sequence tag IST11322H9HMR1
Sequence
GTCTGCAACTGTGGCGGAATTGCTGAGCCNGGAAAGCTTCAGCTGTCTGAATCATTTTCTCTGTGATCTTACAGTGGAGG
AGCTGCTGTTGTCTGAGTCCCAGCTGTGTTTTCCAGACTAATGAGGGACTCTGTCCATGCCTCTCTATCAGGAACCCTAG
TGGAAGGTAGCTTGGGGTTCTTTATGGGAGTCTCTTCANAGCCNTCTGTTGCAAACTGTGAAGAAGGCCAAAAGCCATGT
CNTGGTGATTGTAATTGTCTCCTTN
Sequence Type genomic DNA
Unitrap ID UNI24596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175542023..175542286 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]

 
Come back to gene ENSMUSG00000078893


For any suggestions or comments, please send an email to unitrap@crg.es