Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0237
Clone ID GC0237
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0237
Sequence
GGACNTGAGGNTGTTTTACTGTACGTAGAGGTAGATGTTTNTGCGGAGGAAGCCTGCAGGGGACANAAGTCAGAAGATTN
GTATTTCACTCNCNACCCCNCACCGCCNGTGTGAACATGATTTATTGTGGTTCTGCTTCATTTTGGCCCTCTTNCCACAT
CGAGGAACAGGCTCAGTAAAACGTAGTCGCCTCTTCCTGGTTGGCCCATTGACTTGGATGGCCCCAGATTTGATTTTGGC
CTTCATCCCTTCCACGGAGCCAAATTCATCAGTGTCTGCAAGCCGGTATAGTGGCAGGACGTGGAGTTGTTCATCCTCGG
GACAATTT
Sequence Type mRNA
Unitrap ID UNI205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62276024..62276537 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047146 (AC166359.3) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9CY36]

 
Come back to gene ENSMUSG00000047146


For any suggestions or comments, please send an email to unitrap@crg.es