Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_264C6-3
Clone ID CMHD-GT_264C6-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_264C6-3
Sequence
AGTCTCCGAGAAATTCTCTGGGGAGACCTCAGCTTCAGCTCTGTCACCCACATCTGCTGCCATTGTGGGGGGCTTCACCC
CAAGCCCTAGTGAGGCCATCAGCCCTTGGACTCCCAGTCCCACTGAGAAAAGTTCCTCTTTCACTCGGTCTTTGTCTGGC
TCTGGGTATGGAGCAGTGACGGCTGGCAAACGCAAGGACAGCCCTCCACTGGTGACCCCACCACAGTCACCCCCATCCTC
GCAGCCCCCAGCTATGACTCAGGCCCCTCGCCAGGGAGAGCGTCGCAGGGAACTGGTGAGGTCGCAGACGCTGCCTCGGA
CTTCAGGGGCACAGGCTCGAAAGGCGCTGTTTGAGAAGTGGGAGCAGGATACGGCGAGCAAGGGCAAAGGTGAGACCAGG
GCCAAACTAAAAAGGTCACAGAGTTTCGGTGTGGCCAGTGCCAGCAGCATCAAACAGATCCTGCTAGAGTGGTGCCGCAG
CAAGACTGTGGGCTATCAGCACGTGGA
Sequence Type mRNA
Unitrap ID UNI13610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72213831..72216637 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045667 (Smtnl2) NM_177776 smoothelin-like 2 Gene [Source:MGI (curated);Acc:Smtnl2-001]

 
Come back to gene ENSMUSG00000045667


For any suggestions or comments, please send an email to unitrap@crg.es