Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14827G7
Clone ID IST14827G7
Vector VICTR76
Project tigm

Sequence tag IST14827G7HMF1
Sequence
GTGGCTCACAACCNCCCGTAATGAGATCTGATGTCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAA
TAAATAAATAAATCTTTAAAAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI30988 UNI33166

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14261727..14261833 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 77516353..77516459 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51091196..51091302 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020385 (Clk4) NM_007714 CDC like kinase 4 Gene [Source:MGI (curated);Acc:Clk4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107693646..107693752 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12362527..12362633 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73151510..73151616 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86872217..86872323 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121381265..121381371 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 114583980..114584086 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101167263..101167369 103
NO GENE  

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es