Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_252C10-3
Clone ID CMHD-GT_252C10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_252C10-3
Sequence
TGGCTTCCCACCCGATCAGACATCGGGCCTGCTCCGGATGCAAATGATCCTGTGGATGATCCCCCTGCCCCACCAGGGAA
GAGAACTGTGGGGGACCAGATGAAGAAAAATCCGGCGGCTGATGATGATGATGAAGATCTGAATGATACCAACTACGATG
AGTTTAATGGCTATGCTGGGAGCCTCTTCTCAAGTGGGCCCTATGAAAAAGATGATGAGGAAGCAGATGCTATTTATGCC
GCTCTGGATAAAAGGATGGATGAGAGAAGAAAAGAGAGAAGAGAGCAAAAGAAAAAAAAAAAAAATTGAAATTTTTCTCC
TTTTTTTTT
Sequence Type mRNA
Unitrap ID UNI542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181342831..181350800 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002455 (Prpf6) NM_133701 PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]

 
Come back to gene ENSMUSG00000002455


For any suggestions or comments, please send an email to unitrap@crg.es