Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_266E9-3
Clone ID CMHD-GT_266E9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_266E9-3
Sequence
GACAGAACAGTAAACTAAGCAGACTGTGACCATTGGCCTCCCACTAGCCAGGATCAACTTAGCTCTCCTTTTGTGGTCCA
TGTGCTGCATCGTCTGCCATCAGTGTGCAACCGGCCCCCAACGCAATGTGTGTTTGTCAAACCATGGAAGTGGGGCAGTA
TGGCAAGAACGCAAGTCGGGCCGGAGACCGAGGAGTCCTCCTGGAGCCCTTCATCCATCAGGTGGGCGGGCACAGCAGCA
TGATGCGGTACGACGACCACACTGTGTGCAAACCTCTCATCTCCCGGGAACAGCGCTTCTACCAGTCACTCCCTCCCGAA
ATGAAGGAATTCACCCCAAAGTACAAAGGCGTGGTTTCTGTCTGTTTTGAGGGAGACAGTGATGGTTACATCAACTTGGT
AGCCTATCCTTATGTGGAGAGTGAAACTGTAGAGCAAGATGACACACCAGAGCGGGAGCAACCTCGGCGCAAACACTCCC
GCCGGAGCCTGCATCGGTCTGGCAGTGGTAGTGACCACAAGGAGGAGAAAGCCAGCCTGTCCTTTGAGACCTCTGAGAGC
TCCCAGGAGGCAAAGAGTCCAAAGGTGGAACTGCACAGCCACTCAGATGTCCCTTTCCAGATGCTAGACAGCAATAGCGG
TCTGAGCTCCGAGAAGATCAGCTACCACCCCTGGAGCCTGCGCTGCCAC
Sequence Type mRNA
Unitrap ID UNI13623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107926434..107943365 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032594 (Ihpk1) NM_013785 inositol hexaphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1351633]

 
Come back to gene ENSMUSG00000032594


For any suggestions or comments, please send an email to unitrap@crg.es