Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_252B11-3
Clone ID CMHD-GT_252B11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_252B11-3
Sequence
CCCGCCCAACAACTTCAACCACCTGGTGCACGTGGGCCCTACGGAGGGAAGGCCCAACACCAGGGATGGGGACCCGGGCT
CAGGAACAGAAGAGCAGAGGTGCCCGCAGCTCCGGGCCGCAGCGGCCCCACAGCTTCTCAGAGGCATTTCGGCGGCCAGT
GTCCACGGGCAGTGATGGTCTCCCTGGAGAAACAGACCCATTAAAGAAGAGAAAATCTAGAACATCTCTGTCCGACGAAT
CGTCGTCCCGCCCCCGGGGCCCCCTGACCCCTGCATCATCCATGATAGAGGTCTAACAACGGCCCCGAATTCTCCCTCAA
AATCATGAGTAAAACACCTCCCCCTGATGCCCTCTGGCACCGCCCCCCCCATTCCCAAGAAAGAAGGAATGAAGAAGCAA
ACATCTTATATGACGCCCTACTCCGGCTGGTCCAGGATGTGCTGAACTTCCTACTCAAGAACAGGCTGGGAGGAGGGGTA
ACACCACGGCCCGCCTGGCTCCCCAAGAATAGACGTCTGACTCCTTGCCCCCTTCCTGCTATTCCCTTGGGCTTCCAACA
CCGTCCTACATGCTCCTCTAGGACTGCCGTGCCTCTGGCGCCCA
Sequence Type mRNA
Unitrap ID UNI13624

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6322297..6324830 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024769 (Cdc42bpg) CDC42 binding protein kinase gamma (DMPK-like) Gene [Source:MGI (curated);Acc:Cdc42bpg-001]

 
Come back to gene ENSMUSG00000024769


For any suggestions or comments, please send an email to unitrap@crg.es