Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14587H6
Clone ID IST14587H6
Vector VICTR74
Project tigm

Sequence tag IST14587H6HMF1
Sequence
NTCTGACACCTAGATGGTGTTGGGAGTGAAGCTGTCACCAGGACGTAGAGGACTTACTGAAAAGATGGCTTGGGAGTGAG
GACCTGGGTCCACAATCCCAAGTAACCTTAATCTCCAAAATTGGTCTCGGAAAAAAGCAAAGGTTCCAAGAAAGATAGGC
TTATTAACAAAAGAGAGGCAGGGCCCTGGATGAGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117047011..117047208 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14587H6HMR1
Sequence
GGCAGANATCTTAAGAAGCAGAAATTCTAGCAAGGCTTGAAGCTGAATGTGTAGTCCTCTACTGATGCCCTCTGGGAGGT
CACAGCCTTGGTCTAGTGGTACCCAGTGCCCTGGGAGCTTCTGGCGCATCTTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117047208..117047343 134
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es