Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15102B3
Clone ID IST15102B3
Vector VICTR80
Project tigm

Sequence tag IST15102B3HMR1
Sequence
GTTCCAGAATGAGTGACCCTGCTTGTCTGGCTGGCTCTACCTGANAACACAGACAAGCATGTGCGGCCATACCCAGCATT
TATTTCTTAAGGAGTTTCTAGGGCTTAGTCATGTCCTTGTGTTTGTGTCAAGGCACTTTGCTGACAACCCATCTCCTTGC
CATTCTGATGCTAGTTTTACTGGAAATGACTTCATCGTCTAGACTCGGTATCTTTTCTCTCTTTGCTCTGTTAAACTGAG
ACAGTGACACCCCACAGTGACAGGTAGTCACCTCAAGAAGTACCAAGCAAGGCACTCTTCACTCAGACCTGGACCAGAGC
TTCAGATCCAGATTTAAAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14028943..14029284 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]


Sequence tag IST15102B3BBF1
Sequence
GAACCTGTTTCAGAAGCACAAAATGAGGAAGGACACCTGACCTTAACCTCTCAGTGTGCACCTGTGCATGTACACATGTA
CACACATGCACATATAAAAACAAAGCACCACCATCACCCTACTAAAAACAAAATGAGCTGAAAGGACGAGTTACACTGGA
GGTGCTTGGTTACACTTGGGGAAGGGTGGATAAGCCTAGACTCTGATGTGGGTGTGAGTGGAATATGCTGCCCACAATAC
CCAAGTCTAGAAAACTCCAGCATGAACTACTGAGAGCCCATGTCAGAAAAAGCTATTTTGAGTCCNGCTGGGAAGTTTGG
CTCCCATAAGTGTATAAAATCATGCATGGTGGCACACACCTATAAACTTTGTACTCTGAAAATGGAGGCAGGANAAGTTC
AAGTTATCTTTGACTTCNTANCANGTTTGANGCCNNACTGNACNNTATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14028498..14028946 427
 
EST/CDNA Est Name
  CV306124.1 - CV306102.1


Sequence tag IST15102B3HMF1
Sequence
GAACCTGTTTCAGAAGCACAAAATGAGGAAGGACACCTGACCTTAACCTCTCAGTGTGCACCTGTGCATGTACACATGTA
CACACATGCACATATAAAAACAAAGCACCACCATCACCCTACTAAAAACAAAATGAGCTGAAAGGACGAGTTACACTGGA
GGTGCTTGGTTACACTTGGGGAAGGGTGGATAAGCCTAGACTCTGATGTGGGTGTGAGTGGAATATGCTGCCCACAATAC
CCAAGTCTAGAAAACTCCAGCATGAACTACTGAGAGCCCATGTCAGAAAAAGCTATTTTGAGTCCAGCTGGGAAGTTTGG
CTCCCATANGTGTATAAAATCATGCATGGTGGCACACACNTATAAACTTTGTNCTCTGAAAATGGANGCNNGAGAAGTTC
AAGTTANCTTTGACTTCNNANNANGTTTNANGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14028513..14028946 406
 
EST/CDNA Est Name
  CV306124.1 - CV306102.1

 
Come back to gene CV306124.1 - CV306102.1


For any suggestions or comments, please send an email to unitrap@crg.es