Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14855D2
Clone ID IST14855D2
Vector VICTR76
Project tigm

Sequence tag IST14855D2BBF1
Sequence
CTCTGAAGACTAGAGCTCCAGAGTGAGAGAGCTACAGGGAAGCGGGGCTGGCTAGTCCCTTGGCTGGCCTGACTGACATA
CATCAGACCCTGGCTGCCCTGGGTATAGAAGCAACTCTGAACTTGTCCATGCTAGGCAGATGTGCCTAGCAGGGTTCTAA
CAGGAAGCAGCTGCAGGGTGGCTTGTGCTGCTGCCGGTGACACAAATGTCATCAGGGCCTCAAGAAGGTCAGTTCCCGCC
GGGCAGTGGTGGTGCATGCCTTTAATCCCANCNCTTGGGAGGCAGAGGCAGGAGGATTTCTGANTTTGANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634784..165635095 304
 
EST/CDNA Est Name
  AI427345.1 - CK622678.1 - AW762466.1 - W49202.1 - CA570198.1


Sequence tag IST14855D2HMR1
Sequence
NAGGAGCGAGGTGCTCACTAAGCTGTAGACCTTCGCCTCAGAGGAGATGGCAACTCTTCTCTTCATTCTCCTTGGCTTCT
TGTAACCCGAAGCTTGCTCAAGATCTGGAATTTCCAGGTGTTTCTCTGGGTGATCTGGATCTAAGAGGATACCAAGGAAT
GTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634621..165634785 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14855D2HMF1
Sequence
CTCTGAAGACTAGAGCTCCAGAGTGAGAGAGCTACAGGGAAGCGGGGCTGGCTAGTCCCTTGGCTGGCCTGACTGACATA
CATCAGACCCTGGCTGCCCTGGGTATAGAAGCAACTCTGAACTTGTCCATGCTAGGCAGATGTGCCTAGCAGGGTTCTAA
CAGGAAGCAGCTGCAGGGTGGCTTGTGCTGCTGCCGGTGACACAAATGTCATCAGGGCCTCAAGAAGGTCAGTTCCCGCC
GGGCANTGGTGGTGCATGCCNNNAANCCNANCNNTTGGGAGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634784..165635066 265
 
EST/CDNA Est Name
  CK622678.1 - AW762466.1 - W49202.1

 
Come back to gene CK622678.1 - AW762466.1 - W49202.1


For any suggestions or comments, please send an email to unitrap@crg.es