Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12478B6
Clone ID IST12478B6
Vector VICTR76
Project tigm

Sequence tag IST12478B6BBF1
Sequence
TTAGTGAGTTCCAGGACAGCCAAGGTTACACAGAGAAACCA
Sequence Type genomic DNA
Unitrap ID UNI33734

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95236448..95236485 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 87921337..87921374 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102114327..102114364 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17464288..17464325 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 41061489..41061526 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81601354..81601391 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022390 (Zc3h7b) NM_001081016 zinc finger CCCH type containing 7B Gene [Source:MGI Symbol;Acc:MGI:1328310]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4582327..4582364 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64430677..64430714 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70868005..70868042 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 91155496..91155533 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 142911376..142911413 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34912239..34912276 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 52012915..52012952 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30944019..30944056 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 31096084..31096121 38
NO GENE  

 
Come back to gene ENSMUSG00000022390


For any suggestions or comments, please send an email to unitrap@crg.es