Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12145F5
Clone ID IST12145F5
Vector VICTR76
Project tigm

Sequence tag IST12145F5BBF1
Sequence
CTCTCTTCCCCTCCCTTACAGTGTTCCTCGGAGTGTGGGTCTGGCACACAACACAGAGACATTATCTGTGTGTCCAAGCT
GGGGGCCGAGTTCAATGTGACTTCTCCCAGCAACTGTTCCCACCTACCCAGGCCGCCTGCCCTGCAGCCCTGTCAGGGGC
AGGCCTGTGAGGACAAATGGTTCTCCACTCTCTGGAGTCCGGTGAGTGCCTGGCACCCGTGCCTTGCTCTCCTTGGGCCT
CTAACAAAGAGGCCTGCACTCAGCCNAGCCTCTCTCGGCCCAGGACAACCCAGTCGACCTTTTGTGTTGTCCCACTTCCC
AAAGACTTGCAGGACTGGGGGACCCTCTCCATTTGGGGTCTTATAATGTTCCTGGANAATGTTCTACCACAGTCTCTCAG
AGAGGAAGTGGGTGGNCNGNNNANCAGCCCTGANAACGTTAGACNTCTGATCAGATGGCTGTGGTCTCCCCAGTGTTCTC
NANCCTGCCN
Sequence Type genomic DNA
Unitrap ID UNI31232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95481163..95481651 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST12145F5HMF1
Sequence
CTCTCTTCCCCTCCCTTACAGTGTTCCTCGGAGTGTGGGTCTGGCACACAACACAGAGACATTATCTGTGTGTCCAAGCT
GGGGGCCGAGTTCAATGTGACTTCTCCCAGCAACTGTTCCCACCTACCCAGGCCGCCTGCCCTGCAGCCCTGTCAGGGGC
AGGCCTGTGAGGACAAATGGTTCTCCACTCTCTGGAGTCCGGTGAGTGCCTGGCACCCGTGCCTTGCTCTCCTTGGGCCT
CTAACAAAGAGGCCTGCACTCNNCNNAGCCTCTCTCGGCCCAGGACAACCCANTCA
Sequence Type genomic DNA
Unitrap ID UNI31232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95481357..95481651 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es