Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14787H2
Clone ID IST14787H2
Vector VICTR76
Project tigm

Sequence tag IST14787H2HMR1
Sequence
GGTTTAATTATGTGAAAAGGCTTATAGACNANNAAAAATACACCACACAAACTTGGACTTTGCAAGTTTGGCAGAGGCAA
AATGGTCAGTCACAAATTACCCAAGGGCTTCTGAGGGCAGTGCTAAACTGACAGAATTTAAGGGTGTTCTGAGTTTTTAT
AGCAGTATTGTAATAATTGGAGTGTTTTCTTCTCAAAGTGTGCATGTGTGTGTTTTATGGCAATATTTANGATAAAAACA
TGCACTTGTATGTAACAATATAAGATGATTGTGATTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108619968..108620249 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]


Sequence tag IST14787H2HMF1
Sequence
AACCCTCGTGACTCACAGGATGGGTGACCACGACGCCTAATGGAATGATCAAGATCACGCAGAAGAAGTTGGATTTTTTT
TTTTAAAAAATTACTTATTTACTTATTATGTGANTACNCNGNNNCTGTCTTCAAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032846


For any suggestions or comments, please send an email to unitrap@crg.es