Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11747A10
Clone ID IST11747A10
Vector VICTR76
Project tigm

Sequence tag IST11747A10BBF1
Sequence
AGGTTTGGAGGACGGCTCAGGAATACCTGCCTTGCCCACTTCTATCCTTGCTCAGCATGCCAGAGTGGGGCAGCCCACAT
CCTGCCAGAATTTGAAGGTGGTCACAGAACCACGGAACAGCCAAGAAACCAAGTAGTGGGCAGTGGTTTTCTTGGATGGC
TGCAGAATCCAGAGCTGGTGTAAGCTTTGAAAGTAGTTAGGGTGGTAGATTCCTTAGGCCTTTGTTGTTTTGATGGGGTC
TCCCAGCAGCACAGAGTGAGGACTTCTAAAAGGACTGACTGTGTATCCCCATTGCTCTCTGCAGCCCATGTGCCTCCTAC
GACTTCCTTCTTTCTCCTTCCTCACATTCCCGAACCATCTCCTCCCTTCTCTTTTTGTCCTGGAGTTAGACCCAGGACAT
TACACCCCAGCCTCTANGTCAGTTTCTTTACTCAGTGTCCCTGNNTGTTCTGAGTGTACTCCGGTGACTTGGTGGGTAGG
TTTGTAGTGTCTANGGCTTTCCTGTCTACATCTGTGANANAAAGTGCAGAANTTANTCNNAANGTTNNTCCANAANCCCT
GAAN
Sequence Type genomic DNA
Unitrap ID UNI33032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88297796..88298358 533
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es