Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0372
Clone ID XR0372
Vector pGT0lxf
Project sanger

Sequence tag XR0372
Sequence
CTACTGTTCTACCTCTCGGCTTAGAATATATTCCGCTTGTGGCCCCTCTCACCGCGAAATTGCTTCTTTTTGCGATCCAG
AGAACAACCAACTTTGAGGGGTTTCTTGCAAAACGCTTCTCCGGTTGCACCCTGACAGATGGAACCCTG
Sequence Type mRNA
Unitrap ID UNI2091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75927443..75927536 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017288 (Vps53) NM_026664 vacuolar protein sorting 53 (yeast) Gene [Source:MGI (curated);Acc:Vps53-001]

 
Come back to gene ENSMUSG00000017288


For any suggestions or comments, please send an email to unitrap@crg.es