Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12377A8
Clone ID IST12377A8
Vector VICTR76
Project tigm

Sequence tag IST12377A8HMF1
Sequence
GCTCTACCTCTGGAAAGAGCCTAGTCCCTGTTTCTTCCCTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI33103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99326562..99326621 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST12377A8BBF1
Sequence
ATCACCAGTTCACTAAAAGTAAAACTCTTTGAATTTAAGCATTATTTTAAACATTTGAATAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI30737

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161913: 234858..234925 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166391: 426100..426167 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 253140..253207 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13215406..13215473 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 18991756..18991823 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 43767219..43767286 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022705 (Drd3) NM_007877 dopamine receptor 3 Gene [Source:MGI Symbol;Acc:MGI:94925]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9151858..9151925 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 22912259..22912326 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 24386949..24387016 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93252443..93252510 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5271994..5272061 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55325970..55326037 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12932155..12932222 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 123151516..123151583 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16821061..16821128 68
NO GENE  

 
Come back to gene ENSMUSG00000022705


For any suggestions or comments, please send an email to unitrap@crg.es