Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_294C7-3
Clone ID CMHD-GT_294C7-3
Vector pMS2
Project cmhd

Sequence tag CMHD-GT_294C7-3
Sequence
AACGGAGGCTGGATCTGGAGACTGACCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCA
GGGAAAGGTGTGAAATCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAACGCTTCTTGGAGCT
GCTGAGCCGCTCAGCTGATGGTGTCGTTGACCTGAACTGGGCAGCTGAGGTGCTGAAGGTGCAGAAACGGCGCATCTATG
ACATCACCAATGTCCTGGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAATCATATCCAGTGGCTGGGCAGCCACACC
ATGGTGGGGATTGGTAAGCGGCTTGAAGGCCTGACCCAGGACCTGCAGCAACTGCAGGAGAGTGAGCAGCAGCTGGATCA
CCTGATGCACATCTGTACCACACAGCTGCAACTGCTTTCGGAGGACTCCGACACCCAGCGCCTGGGCCTATGTGACCTGC
CAGGACCTTCGCAGCATTGCAGACCCTGCAGAACAGATGGTCATAGTGATCAAGGCCCCTCCTGAGACCCAACTACAAGC
TGTGGATTCTTCAGAGACATTTCAGATCTCCCTTAAGAGCAAACAAGGCCCCATTGATGTTTTCCTGTACCCGGAGGAGA
GTGCAGACTGGATTAGCCCCGGGAAGACCTCATGCCAGGAGACATCCTCTGGGGAGGACCGGACTGCAGACTCTGGCCCA
GCAGGGCCTCCAC
Sequence Type mRNA
Unitrap ID UNI13642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154386830..154390240 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027490 (E2f1) NM_007891 E2F transcription factor 1 Gene [Source:MGI (curated);Acc:E2f1-001]

 
Come back to gene ENSMUSG00000027490


For any suggestions or comments, please send an email to unitrap@crg.es