Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12233E1
Clone ID IST12233E1
Vector VICTR76
Project tigm

Sequence tag IST12233E1HMF2
Sequence
CTATGATTCAGGGGTCCTTAGAAACAAAGAGCTTGAAGATAATAAAGAGCTCCTGGAAACCAACCCCANNNGGCTACATT
CTAGGGAAGTAGAAGAGTTAAGGGAATTTAGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52819415..52819530 110
NO GENE  


Sequence tag IST12233E1BBF1
Sequence
TTTTGATATCNTTCAAATTGATCCCATGTTGTCTTGGGAAGCCTGATGATGATGATGATGATGGTGGTGGTGGTGGTGNT
GANTTN
Sequence Type genomic DNA
Unitrap ID UNI1971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107784037..107784120 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]

 
Come back to gene ENSMUSG00000035873


For any suggestions or comments, please send an email to unitrap@crg.es