Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10162F9
Clone ID IST10162F9
Vector VICTR76
Project tigm

Sequence tag IST10162F9HMF1
Sequence
GACCTTTGGAGGAGCAATCAGTGCTCTTAACCGCTGAGCCATCTCTCCAAACAAACCCGAGTACTTTTAAGGGCAAGGGC
ACTGCCATGAGATTGAGACAGTGGTGGGGAACCTTGGCTGCTGCCCTTAATTCCCTGTAAGTTTTTACCAAGAGTTTTTG
TTGAAACAAAAAGTGACAACTGTGGTTACTCAATCAATGCTTTAGCCCTGGAAGGGGCAGCCTCGTTAATTCTTGGATTA
ACCAAATGTCACCATAGCCCTTTAATCGCCTAACCACCTCACTGGCAAGTCGGCCCAGCGAAGCGCCGNTCTANCCGGCC
TGCTCGTCTCTATGGCTTTCCTGCTTCTGATTGGCGTAGTCGCGAGCGGTGCGTGATGACGTCACTACAAGGCGACGTTA
CTATAAGACCTCGGTCCAACCGCCTTGTCTCTCTTTGTCTCGGGCCTGANTTCGTANGTGAGTGTTCTGATTGTTGAGTT
CGCCTTTTANGGGTTGATGGTGTAAGGTAACGGAGCNNTTCNAATNNTCATGAACNTGCTGAGTAAN
Sequence Type genomic DNA
Unitrap ID UNI33737

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3655210..3655755 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006333 (Rps9) NM_029767 ribosomal protein S9 Gene [Source:MGI (curated);Acc:Rps9-001]


Sequence tag IST10162F9BBF1
Sequence
GACCTTTGGAGGAGCAATCAGTGCTCTTAACCGCTGAGCCATCTCTCCAAACAAACCCGAGTACTTTTAAGGGCAAGGGC
ACTGCCATGAGATTGAGACAGTGGTGGGGAACCTTGGCTGCTGCCCTTAATTCCCTGTAAGTTTTTACCAAGAGTTTTTG
TTGAAACAAAAAGTGACAACTGTGGTTACTCAATCAATGCTTTAGCCCTGGAAGGGGCAGCCTCGTTAATTCTTGGATTA
ACCAAATGTCNCCNTANCCCTTTAATCGCCTAACCACCTCACTGGCAAGTCGGCCCAGCGAAGCGCCGCTCTANCCGGCC
TGCTCGTCTCTATGGCTTTCCTGCTTCTGATTGGCGTANTCGCGAGCGGTGCGTGATGACNTCACTACNAGGCGANGTTA
CTATAAGACCTCGGTCCNACCGCCTTGTCTCTCTTTGTCTCGGGCCTGANTTCGTANGTGAGTGTTCTGATTGNTGAGTT
CNCCTTTTAGGGGTTGATGGTGTAAGGTAACNGANCNNTTNNAATCTTNATGAACATGCTGAGTAAGANGGTGGGGCNAN
Sequence Type genomic DNA
Unitrap ID UNI33737

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3655210..3655766 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006333 (Rps9) NM_029767 ribosomal protein S9 Gene [Source:MGI (curated);Acc:Rps9-001]

 
Come back to gene ENSMUSG00000006333


For any suggestions or comments, please send an email to unitrap@crg.es