Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10792D3
Clone ID IST10792D3
Vector VICTR76
Project tigm

Sequence tag IST10792D3HMF2
Sequence
GAATCATTGAGAAAAATGCCTGTGGGTAAGTCTGTCTGTCTGACATTTTCTTTTATTCATATGAGTACACTGTAGCTGTC
TTCAGACACACACCANAAGAGGACATCGGATTCCATTANAGATGACTGTGAACCACCATGTGGTTTCTGGGGATTGAACT
CAGGATCTCTGGGAGAGCAGTCTGTGCTCTTAATCACTGAGCCATCTCTCCAGCCCTGTCTGGCATTTTCTTGANTAAAG
ATTACTGTGAGAAGGTCTGCCCACTGTGGGCGGTGCCNACAACAAGCCAGGAGGCANTGCTCCCTTGTGGACTCTGCTTC
ANTTCCTGTCCTGACTTCCCTCAATGATGGAGTGTGACCTGAGAGTTGTTAGCTNANTAAGCNCTTTCCTCNACAGGTTG
ANTTTGGA

Sequence Type genomic DNA
Unitrap ID UNI22780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84647930..84648336 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027078 (Ube2l6) NM_019949 ubiquitin-conjugating enzyme E2L 6 Gene [Source:MGI (curated);Acc:Ube2l6-001]


Sequence tag IST10792D3BBF1
Sequence
NTATATAAATTTAGCCCTAAGATTCCAGTGCCAAGACCAATTTAATTCATTTGCTCGGTTACAAGTTAAGAAGAAAGAAC
TTTCTTAGTGCATTAGCTATCTGCTACTTTGGTATAATGACCATCTGAATCTATGGATTTTCTATAATTATCTTTTGCTA
TGGTGACTAGCTGTCCAGTCNGTGGGGAAAAAGTATTTCATTTTTATTGCACTGATAACACTTGGCTGGTAACAGATGTG
AATACCNNCGTTCTTTTTCCTTTGTAGTAATTGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67897856..67898131 270
NO GENE  

 
Come back to gene ENSMUSG00000027078


For any suggestions or comments, please send an email to unitrap@crg.es