Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_278D4-3
Clone ID CMHD-GT_278D4-3
Vector pMS3
Project cmhd

Sequence tag CMHD-GT_278D4-3
Sequence
GTCAGGACCGAGCTGCATGCCTCCGATCCTGCCCACGTCCTCATGTGGAAGGAGTCCCCAGAATGCTGGAAGACCATTGT
TGCTGAAAAACCTTCCAATCAGCTCCCGAATGGCCCCTGCTACTCTGGATTCCTATGGGACACAGCAACCAACGTGGAAC
TGAGAGACATCCCCGGGCGGGAGAGCTCACCCACCAACGGTCATGCTAAGGCTGTGGGCCCCAGCCCTTTCCTCGCCAGA
TTCAAGGTGGGAAGTAATGACTTAACCCTGGTTAACCTCCAGCTGACAGCCCTGGCCCTCCCAGGAGCTGAGAATTCAAG
CAAGAATCACAGTGATGGCCACCGATTATTGAACTTTGCACTAACCCTCCAGGAAACCCTGAAAGGAGAAAAGGATGTTG
TTATTTTAGGGGATTTTGGCCAAGGGCCAGATAGCAATGACTACGATATCCTAAGGAGAGAAAAATTTCACCACCTAGTC
CCGGCTCACACTTTCACCAACATCAGCACCAGGAATCCTCAAGGCTCCAAGTCTGTGGACAACATCTGGATCAGCAAAAG
CTTAAAGAAAGTGTTCACAGGTCACTGGGCTGTTGTGAGAGAAGGGCTCACAAACCCTTGGATTCCAGATAACTGGTCCT
GGGGTGGAGTCNCTTCTGAACATTGCCCTGTGCTTGCTGAATTGTACATGGAAAAGGACTGGAGCAAGAAGGAAGTCCCC
AGGAATGGCAAT
Sequence Type mRNA
Unitrap ID UNI13647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25389478..25411145 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036611 (Eepd1) NM_026189 endonuclease/exonuclease/phosphatase family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914734]

 
Come back to gene ENSMUSG00000036611


For any suggestions or comments, please send an email to unitrap@crg.es