Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0787
Clone ID AL0787
Vector pGT0lxr
Project sanger

Sequence tag AL0787
Sequence
GCATAAACAAGAGTGGGGACGGGATGAGGCGGCAGTTGGTCCCCGCGCAGCGAGAGGCGGCGAGCGGGGCGACCTGCCGG
ACCGGACGTCGATCCTGAGTGTAGCGTGCTCCCGCGGGCCGCCCGAGTCGAGCTGCGCGCGCTCCCGCCAAGGGGGGTCC
GAGGCCGTCGCGCGCTCGCAGCCATGAACCTGGCGAGCCAGAGCGGAGAGGCCGGCGCCGGCCAGCTGCTGTTCGCCAAC
TTCAACCAGGATAACACGTCCCTAGCTGTTGGTAGTAAGTCCGGGTATAAGTTTTTCTCCCTTTCTTCTGTGGATAAGCT
GGAACAGATCTATGAATGCACTGACACTGAAGATGTCTGCATTGTGGAGAGATTGTTCTCAAGCAGCTTGGTGGCCATTG
TCAGCCTCAAAGCTCCCAGGAAGCTGAAGGTTTGCCATTTTAAGAAGGGAACTGAGATATGCAACTACAGCTACTCCAAC
ACTATCCTGGCTGTGAAGCTGAACAGGCAG
Sequence Type mRNA
Unitrap ID UNI2092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143105530..143131971 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029578 (Wipi2) NM_178398 WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI (curated);Acc:Wipi2-001]

 
Come back to gene ENSMUSG00000029578


For any suggestions or comments, please send an email to unitrap@crg.es