Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13658C3
Clone ID IST13658C3
Vector VICTR74
Project tigm

Sequence tag IST13658C3BBF1
Sequence
ATTGCAGTGCTATCTGCATCTAGTGGGGAGAGGCCAGAGATCCTGTTAAATGTTCTGTAATGTGCTGAACAGCCCCCACA
GCACAGGCTAGCCAGCTCAAAGTAACAACATCGAAACAAAGGAACCCTGCACCGACTGGTACGCCCTGCTTTGTCTCATT
CAAGCCCTGATAACCTGAATTTGATACCTGGAATCCACGTGGTGGAAGGAGGGAACCTGCACCCTCAAGCCATCCTCTGG
TTTCCGTGCACACGCANAANANATGGTGGGCGTTGGGCGTGGGGTGGTGGCATTATATATATATATATTTTTTTTAAAAT
TTATTTATTATTATATGTAAGTACACTGTAGCTGTCTTCANACACACCANAANNGGGAGTCAAATCTG
Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95074632..95075018 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]


Sequence tag IST13658C3HMF1
Sequence
ATTGCAGTGCTATCTGCATCTAGTGGGGAGAGGCCAGAGATCCTGTTAAATGTTCTGTAATGTGCTGAACAGCCCCCACA
GCACAGGCTAGCCAGCTCAAAGTAACAACATCGAAACAAAGGAACCCTGCACCGACTGGTACGCCCTGCTTTGTCTCATT
CAAGCCCTGATAACCTGAATTTGATACCTGGAATCCACGTGGTGGAAGGAGGGAACCTGCACCCTCAAGCCATCCTCTGG
TTTCCGTGCACACGCAGAAGAGATGGTGGGCGTTGGGCGTGGGGTGGTGGCATTATATATATATATATTTTTTTTAANAT
TTATTTANNANTANNTGTNNNTACACNGNANCTGTN
Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95074664..95075018 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es