Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11886A3
Clone ID IST11886A3
Vector VICTR76
Project tigm

Sequence tag IST11886A3BBF1
Sequence
ATTGGTAGAGCCNTTCATAGCACTCAGGAAAACATGATTTTGGGTACCCAGTTTATTAATGCATTTACTAAAGGGTATAG
CTGTACAGGCAGATAGAGGTGTGCAGGTAAGGTTTGTGGGAGCTTTCCTGATCTCCTGGGGGGGCCATCCTTCCAGTATC
CTCCTGCTCTTGGGACCTANTCCTCTN
Sequence Type genomic DNA
Unitrap ID UNI1052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147408768..147408953 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029016 (Clcn6) NM_011929 chloride channel 6 Gene [Source:MGI (curated);Acc:Clcn6-001]

 
Come back to gene ENSMUSG00000029016


For any suggestions or comments, please send an email to unitrap@crg.es