Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14629F7
Clone ID IST14629F7
Vector VICTR74
Project tigm

Sequence tag IST14629F7BBF1
Sequence
CCTGGGCTGAGTCTGGGGATGTTAAAAGGAGGGTAAAGATACATGGACTGTGACCCTATCTCAGGCTGAAACATCCCTAG
GAACTGGTGATCATACACATCTGCCAAAACCCAGCATCCCAAGGTCCCCAAGGCAAGCCCGCTTACACTGCCTAATGCTC
CCTCTGTCCCCTCCAGGGCCAGTGGCCAGCCCTTTCCTGGGCAGGGACTAAGTGAACTGATACCTTAATGGTTCAGCAAA
CTCATAGACCATACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525946..110526205 260
 
EST/CDNA Est Name
  BY348584.1 - BB873695.1 - W85483.1


Sequence tag IST14629F7HMF1
Sequence
CCTGGGCTGAGTCTGGGGATGTTAAAAGGAGGGTAAAGATACATGGACTGTGACCCTATCTCAGGCTGAAACATCCCTAG
GAACTGGTGATCATACACATCTGCCAAAACCCAGCATCCCAAGGTCCCCAAGGCAAGCCCGCTTACACTGCCTAATGCTC
CCTCTGTCCCCTCCAGGGCCAGTGGCCAGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525946..110526136 191
NO GENE  


Sequence tag IST14629F7HMR1
Sequence
GGTACTTGGGAAGGTCTTTGAGATCGGGTGATTTCTATCCTGAGCTGTACCCCATGCCACCAGCTTTGGCTAGCAGGAGC
CAGTTGTTACCTCCACCTATTTGACACAGGAGAAACTGTTCCAGCCCTGGTGTGAATCANGATGGACACACACGCTGCCC
CCAGGGACTCCTGACAGCAGATCTGAGGATTTCTTCATATTTCTGCANAGTTCCTCCTTCTGAGATTCAAGAGAANCANG
CTCCAANCTCCGTCC
Sequence Type genomic DNA
Unitrap ID UNI15873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525694..110525947 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032491 (Nradd) NM_026012 neurotrophin receptor associated death domain Gene [Source:MGI Symbol;Acc:MGI:1914419]

 
Come back to gene ENSMUSG00000032491


For any suggestions or comments, please send an email to unitrap@crg.es