Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14201F10
Clone ID IST14201F10
Vector VICTR74
Project tigm

Sequence tag IST14201F10HMF1
Sequence
CTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGTATTTGGACCTCCTCCTGGCCGAAGAAGAAGGC
CCAAAACAGGACCTTTCTCAGACACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAAT
TCCTAAGC
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI15232 UNI30808 UNI30809 UNI30811 UNI31345 UNI31952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616319..11616485 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255706..5255872 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826566..7826732 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 11554944..11555110 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4074259..4074425 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7462075..7462241 167
 
EST/CDNA Est Name
  BU846768.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4724928..4725094 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022181 (C6) NM_016704 complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14815094..14815260 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14900579..14900745 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 17705536..17705702 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647659..20647825 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14209653..14209819 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026712 (Mrc1) NM_008625 mannose receptor, C type 1 Gene [Source:MGI (curated);Acc:Mrc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5055021..5055187 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12252615..12252781 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987365..3987531 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6939101..6939267 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042505 (Acn9) NM_001077713 ACN9 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Acn9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110563..5110729 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912974..3913140 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 11416458..11416624 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114544..114710 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906465..4906631 167
NO GENE  

 
Come back to gene ENSMUSG00000042505


For any suggestions or comments, please send an email to unitrap@crg.es