Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10940E6
Clone ID IST10940E6
Vector VICTR76
Project tigm

Sequence tag IST10940E6HMF2
Sequence
NANATATGTGTAATTATTGGTGACATATTTAAGTGAGCTCAGAAATGTAAAACANATGTCATTAGCTGTAGCTGTGTGTA
TCACATTATAGATCTCAGTAGTTAACG

Sequence Type genomic DNA
Unitrap ID UNI30717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177358885..177358987 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]


Sequence tag IST10940E6BBF1
Sequence
GAGATATGTGTAATTATTGGTGACATATTTAAGTGAGCTCANAAATGTAAAACAAATGTCATTAGCTGTAGCTGTGTGTA
TCACATTATAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI17179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174839666..174839760 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078906 (OTTMUSG00000016627) predicted gene, OTTMUSG00000016627 Gene [Source:MGI Symbol;Acc:MGI:3652325]

 
Come back to gene ENSMUSG00000078906


For any suggestions or comments, please send an email to unitrap@crg.es