Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10035D7
Clone ID IST10035D7
Vector VICTR75
Project tigm

Sequence tag IST10035D7HMF1
Sequence
GAGGGTAAGGCCAGGCATGCTTTGAGAGCAGTAGGGAGTTCGGTCTGAATTCATACGTGAAGTTGGAGGTGGGCTCTAGT
CTTGGGAGTTCCTAGAGGCCACAAGAGGGGTCCTTGGGCTGCAAATCCTGGGTTCTTCTCTAGACTAGTGAAGTACTCCC
AGAGAGCAGAGCCTAAGGGTGGCGTTGAACGCAAAGCTATCTGGTCCGCCCTCTAGTGGAGAACCCACATCACTGCGATT
TCCTGAACCTGATTTGGATGTTGGTGCAGACCCACCTTCAGGACTTGAAAGAGGTGACCCACGATCTGCTCTACGAGGGC
TACCGGGCTCGCTGCCTACAGAGTCTGGCTCGACCTGGGGCCCGGGATCGAGCCAGCCGCAGGTGAGAGCAGGGCTATTT
TGGTGCTTCCATGGCGCCGCCGTTTGGGCAAGCCTTCCTGACTGGTCCTGCTACCCTTCTTAACTCGGCTTCCCAATCCA
ACTAAGCCTCTCCGACACTGACCTTAACCTCAGGGACAAGGCCCCGCCTCCTACACTTCAGAATTGCCCCAAGCCTAG
Sequence Type genomic DNA
Unitrap ID UNI25123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134358618..134359176 538
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000486 (Sept1) NM_017461 septin 1 Gene [Source:MGI (curated);Acc:Sept1-001]


Sequence tag IST10035D7BBF1
Sequence
GAGGGTAAGGCCAGGCATGCTTTGAGAGCAGTAGGGAGTTCGGTCTGAATTCATACGTGAAGTTGGAGGTGGGCTCTAGT
CTTGGGAGTTCCTAGAGGCCACAAGAGGGGTCCTTGGGCTGCAAATCCTGGGTTCTTCTCTAGACTAGTGAAGTACTCCC
AGAGAGCAGAGCCTAAGGGTGGCGTTGAACGCAAAGCTATCTGGTCCGCCCTCTAGTGGAGAACCCACATCACTGCGATT
TCCTGAACCTGAGGCGGATGTTGGTGCAGACCCACCTTCAGGACTTGAAAGAGGTGACCCACGATCTGCTCTACGAGGGC
TACCGGGCTCGCTGCCTACAGAGTCTGGCTCGACCTGGGGCCCGGGATCGAGCCAGCCGCAGGTGAGAGCAGGGCTATTT
TGGTGCTTCCATGGCGCCGCCGTTTGGGCAAGCCTTCCTGACTGGTCCTGCTACCCTTCTTAACTCGGCTTCCCAAATGC
AACTAAGCCTCTCCACACTGACCTTAACCTCAGGGACAAGGCCCCGCCTCCTACACTCAGATTCGCCCCAT
Sequence Type genomic DNA
Unitrap ID UNI25123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134358625..134359176 542
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000486 (Sept1) NM_017461 septin 1 Gene [Source:MGI (curated);Acc:Sept1-001]

 
Come back to gene ENSMUSG00000000486


For any suggestions or comments, please send an email to unitrap@crg.es