Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_297D6-3
Clone ID CMHD-GT_297D6-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_297D6-3
Sequence
TGTATTTTGGCGAATACCAACACGTACAGCAGGAGTACGGGGTACACCTGAGACTTGCCAGTGGTGACACTCCAAAGCCA
AGGAATTCCCAGCCCTCAAAGGCAGGCTCCTATGGTGTCAGCATCAGGGTCCAGGGAATTGATGGCCACCCTTATATAGT
CCTGAATAACACTGAGCGGTGTCTAGCAGGCACACCTTTCCCAAAAAACGCGCCATCGTTTCCATCTTCAGTGATAAATA
ACCTGTCCCTACATCCAAGCAACGGAACCGTGTTGAAGGAGAACACTCCGGAGGAACTGCAGCTTCCAAAAAACCCGTAC
CTGCAAACCAGCCCGCTAAGAGGCCAGAAGCAGTTCTCCCTCCACGAGGGCAGGAATGGAGTTCTAGAACGCAAAGACGG
GCCCACGAAGCTGCCCCATGTGCTCAACTTCCAGAGGCACCCGGAGCTTCTGCAGCCCTATGACCCAAAAAAAAAAAAAA
AAAAAAAAAAAAAATTTTTTCTTTTTTTACACCATTTAAAAAAAGANNTGCACCAGAGGACGGGACCAACTGTAAGAAGT
CCCGGAACTGCTTCCCCAAATCCTACGGTTCCCAGCCCAACAGCCCTACTTCGG
Sequence Type mRNA
Unitrap ID UNI13656

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71573256..71573867 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]

 
Come back to gene ENSMUSG00000032232


For any suggestions or comments, please send an email to unitrap@crg.es