Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10895D5
Clone ID IST10895D5
Vector VICTR76
Project tigm

Sequence tag IST10895D5HMR1
Sequence
GAGAGAAATTGTACNGTTTTTTTCTTTTTTTCTTTTTGTGTTTGTTCTTTATCCACTGTGCAAGTCTGAATGTTAGGACC
CTAAATTCAGCTTGTTCAGTTCGGCATTTTTATTTCCCTTCCCACTGGCCCTTCCTTTCCACGTCATCTTTAGCAAGGAG
AGTCATCTTTGGGTCATATATGCTANAAGTCAATATGANAAAAGGAAAGTTGTCCCGANAGAAGCAGACTGTGCNTGCTG
GCTTGGACAGATGACCNNNCCN
Sequence Type genomic DNA
Unitrap ID UNI31932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81180404..81180658 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]


Sequence tag IST10895D5BBF1
Sequence
GTTTGTTTGTTTGGATATGGGATCAAACTTGCTATGTAGCCNAGGCTGGCATTGAACACCTGGTTGTCCTGTGCCCACCT
CCTCCTAAGTGCTGGAAGTACAGCTATACGCCACCATGCTTGATTCTCTTTTTACTTTCAAGCTGAATTTACTCGTTCTC
TCTGGCTATGANAACTCACTCTTNTGTACTGAAGAGTTAGCTGCTGACCTGGCCTTTCCCANGCAGATCAACAGGAACNA
NAACAACTGANGTCCAATCAATCAATGCTCACAGCGTGATGGGTGTGGGTGTTTGCTGTGTTTTCCAGGGAAACTTCATT
AAACTTCTGAACATTCACAGATGTNAAACACTGTAAGGNAACTGGAGAAGTGCCCTACTTCTTAANTAACTCTATGGAAT
TCCTTATN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81179991..81180397 387
NO GENE  


Sequence tag IST10895D5HMF1
Sequence
NTTGTTTGTTTGGATATGGGATCAAACTTGCTATGTANCCAAGGCTGGCATTGANCACCTGGTTGTCCTGTGCCCACCTC
CTCCTAANTGCTGGAAGTACAGCTATACNCCACCATGCTTGATTCTCTTTTTACTTTCAAGCTGAATTTACTCNTTCTCT
CTGGCTATGANAACTCACTCTTCTGTACTGAANAGTTANCTGCTGACCTGGCCTTTCCCANGCNNATNANCNNGAACAAN
AACNACTGANGTCCAATCAATCAATGCTCACAGCGTGATGGGTGTGGGTGTTTGCTGTGTTTTCCANGGAAACTTCATTA
AACTTCTGAACATTCACAGATGTAAAACACTGTANNGAAACTGGANAANTGCCCTACTTCTTAAGTAACTCTATGGAATT
CCTTATCCNTAGGCAGCANGCCTGGGAAGCNNCANGNANAANTGAANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es