Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_285E1-3
Clone ID CMHD-GT_285E1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_285E1-3
Sequence
GTGAGCCGGGCCTTGTTTGAGCTGACGAACCTGGAATCTCCCGAAGAACTTATCGAGGTCTTCATTTACGGCTCTCAAAA
CAACAAGATTCGGGCTAAATGGATGCTTCAGTCCATGGCTGAGAGGTACCCCCTGCGCCAGCAAAAAGGAGTGCTGAAGC
TGGAGGAATCCATGAAGACCCTGGAGCTAGGCCGGTGTATCGAGTGAAGCCAGTTTCCAGTCCTTGTGTCTCCGACCTGG
ATGCAGGTTAAGCTGTGGCCAGTGTTTGGTTCTGGCGGGATTTTTAGCTTTGTTACCTCCTAGCAAGATATTCCTGGATC
CCTGCTGCGCATTCTGATGTGAATCCCAAGGTTACCACTCTAAATAAAAAATAAAATTGAAGCG
Sequence Type mRNA
Unitrap ID UNI13658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78214868..78215675 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060461 (Dppa5a) NM_025274 developmental pluripotency associated 5A Gene [Source:MGI (curated);Acc:Dppa5a-001]

 
Come back to gene ENSMUSG00000060461


For any suggestions or comments, please send an email to unitrap@crg.es