Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14491E4
Clone ID IST14491E4
Vector VICTR74
Project tigm

Sequence tag IST14491E4BBF1
Sequence
CCCTCTTGTCCCCACTCCTGGTCACTGCTCTTGTGGATGAACTCAGAGGTCAGATAGATAGACGATAAAGGATTTTCAGC
TGCACACCCGGCACACACATCCCAATTATACATTCCAGGCCCCATGATGGAGAGCACTACCTCTTTCCCCTCCACCTCAA
CCTGAAAAATTAATTTGTTAAGAGTGGAAGCCTCACCGAGCGGTGGTGGCGCATGCCTTTAATCCCAGAACTTGGGAGGC
ANANGCNNGTGANTTTCTGAGTTCGAGGTCANCCTGGTCTACAAAGTGAGTTCNNNGACANCCNGGGCTATACAGAGAAA
ACCCTGTCTCGAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95122262..95122606 320
NO GENE  


Sequence tag IST14491E4HMR1
Sequence
AGGGTAAAGTCCTTGAGCTGGAATACTGACTGGCCTGTGACATGCCGAGAGGGATTTCGCAAGTGCTTCTGTGAAAGGTG
GAGGCGGGGCTGTTGAAANANCCNACCAGACCCAGGACCAGCCTAGCTCAGCTGTGGACTGAGGGCTCTGTCCTCCTTCN
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95122603..95122761 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]


Sequence tag IST14491E4HMF1
Sequence
CCCTCTTGTCCCCACTCCTGGTCACTGCTCTTGTGGATGAACTCAGAGGTCAGATAGATAGACGATAAAGGATTTTCAGC
TGCACACCCGGCACACACATCCCAATTATACATTCCAGGCCCCATGATGGAGAGCACTACCTCTTTCCCCTCCACCTCAA
CCTGAAAAATTAATTTGTTAAGAGTGGAAGCCTCACCGAGCGGTGGTGGCGCATGCCTTTAATCCCAGAACTTGGGAGGC
AGAGGCAGGTGAATTTCTGAGTTCGAGGTCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCNGGGCTATACAGAGAAA
CCCTGTCTCGAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95122264..95122606 341
NO GENE  

 
Come back to gene ENSMUSG00000015714


For any suggestions or comments, please send an email to unitrap@crg.es