Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_285E2-3
Clone ID CMHD-GT_285E2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_285E2-3
Sequence
GCAGGTGTTTGCGGATCAGTGCCCCCTGGAAGTGAGTCATAGGCATTGTTCAAGAAGGAAGCAGCTAAGACAACATGAAT
G
Sequence Type mRNA
Unitrap ID UNI304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 93510074..93510154 81
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44381810..44381890 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es