Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11582G1
Clone ID IST11582G1
Vector VICTR76
Project tigm

Sequence tag IST11582G1HMR1
Sequence
ATGCTATCTCCTTATGGAGACAAGGAGCACACTGGAGCCTTCAAAGGCCCTAGCTGGGTGTGTGTGTGTGATGCCNGGTC
AGATGGACTGCGGTGATCANATGCTTATTGTAGGAGCATTTCTGGGCATTTCAGCTTTTGAAGATTCTAAGT
Sequence Type genomic DNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48546958..48547110 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]


Sequence tag IST11582G1BBF1
Sequence
NCATGAACTAAATAACAAAACANGTTAACTTCAAAGAGGCTTTTAAGTCTAAAAAGGAACAAAAATGTGTATTAGACTCC
TAAAGGGAAATACAGTAAATGGAGTTTGGGGGACAGAGGCTTTTCCACTGGGGACAAACCANGGAAAGCACTGGGAAAGG
GTGTCATGTGAGTTAGGTTTAAGTCTGANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48547108..48547299 186
 
EST/CDNA Est Name
  BB847300.1 - BI666402.1 - BI697761.1

 
Come back to gene BB847300.1 - BI666402.1 - BI697761.1


For any suggestions or comments, please send an email to unitrap@crg.es