Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0337
Clone ID AL0337
Vector pGT0lxr
Project sanger

Sequence tag AL0337
Sequence
CTTCCCGCTAGCGCTACTTTATTTTCTCCGCGTGTATATACTATGCTCCTGTTATTTCGATCTCTCTACCTTTCGCGTTC
AGCTTTTTCTTACTTTCCTCGCAAACTGTGGAGAAATATTGAACCTCACCTGAAGAAGGCAATGCAGACTGTGTATCTCA
GGGAGATCTCAAGTTCCCAGTGGGAAAAGTTACAGAAAGATAACACAGACCCAGGACAACTGAAAGGTCTCTCGGCGTAC
ACCCACATGGAACTTCCATATTACTCCAAGTTTATTCTTATTGCTGCATACCTTGCCTCTTATAACCCAGCGAGAACTGA
TAAGAGGTTCTTCCTTAAGCATCATGGGAAAATCAAGAAGACTAACTTTCTAAAGAAGCATGAGAAG
Sequence Type mRNA
Unitrap ID UNI2097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22029320..22032256 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029012 (Orc5l) NM_011959 origin recognition complex, subunit 5-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Orc5l-001]

 
Come back to gene ENSMUSG00000029012


For any suggestions or comments, please send an email to unitrap@crg.es