Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_272H1-3
Clone ID CMHD-GT_272H1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_272H1-3
Sequence
GACCTGAAAGAAAAGAAGGACAAGGTGGAGGAGAAGGCCGGCCGGAAAGAACGGAAGAAAGAAGTAGTGGAGGAGGAGGA
GAATGGAGCTGAGGAAGAGGAAGAAGAAACTGCAGAGGATGGAGAGGATGATGATGAAGGGGATGAAGAAGATGAGGAAG
AAGAGGAGGAGGATGAAGGCCCCGTGCGGAAGAGAACTGCTGAAGAGGAGGATGAAGCAGACCCCAAGAGGCAGAAGACA
GAAAACGGGGCGTCGGCATGAACCCCTGCCCGTGGGCTTGGGGATGGGAGGCCCCTCAGGTCCTGGAGGTGGGGCGGGAA
CACACAAATCCAGCCCCCTTTCTCCTGGCTCCCTGCTCTGGCCCTGCCCCAGAGCTGTGACCCTTGTCCTTTGACCCAGC
CTCTCATTTCCATCTCTCCAGACACTGGCTCCTTCACCCTCACTGCCACCGGTCCAGCTCCTGACCCGCCTCATCTGAGC
TCCCCAGCCAGCCCTCACTTGCCCTAGCATTCTTGTTCTTCTTTCCTGCCTTCCCTCACCATCCCATATGTTCCGGTCCC
TGCGAAGCCTCTCCTTGCCCTCTACACCCCGAGCCTCTCAGCCTGCCCTTCTTTCTCCTGCCTGACCCCTGGGTCTCCCT
CAGATTCCCTCCTCTCAGACAGCGCCAGGCCGGGGTGGGGCTGGGGTTGGGGCCAAGCCCCGAAGCTGCCCCCTCCCCTT
TTTGTATAATTTAATAAAGAAACGGTCGCGCTTCTGTTTTT
Sequence Type mRNA
Unitrap ID UNI13667

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124863701..124865007 549
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030122 (Ptms) NM_026988 parathymosin Gene [Source:MGI (curated);Acc:Ptms-001]

 
Come back to gene ENSMUSG00000030122


For any suggestions or comments, please send an email to unitrap@crg.es