Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14490F6
Clone ID IST14490F6
Vector VICTR74
Project tigm

Sequence tag IST14490F6HMR1
Sequence
GTGTATATACTTACAAATTGAATGATGTGTAATGAAAGACTAATTTATGAAGAAAAACCTATTTTGGTTGGATGTTAGAA
GAATTCAGTATGTAACCTTGAAACGTAAAACTAGAGGATCAGTAGTAGAATGTAACTTTAGAGAGGTCAGGAAAGACACT
GGAGGTACCAGGAATAAAGAGCTGGTGCCCTTTAGGAAAGGCAAGGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI30053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61742005..61742215 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]

 
Come back to gene ENSMUSG00000047804


For any suggestions or comments, please send an email to unitrap@crg.es