Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13016F7
Clone ID IST13016F7
Vector VICTR76
Project tigm

Sequence tag IST13016F7HMR1
Sequence
NNNTCCCGCCTTCTTTTATTTTTGGCTAATGCCGATATTGATGCAATCAGCAGGCATGCCTTCATCTTCCATGCGATTCC
GGGTTTTGTGCCAGGCTTCNGACACAAGATGAATTACCCCGAAACAAATATACAGTTCTCACTTAAAAGAGTGCTTTTGT
TTGTTTGTTTGTTTGTTTGTTTCTTTTTTGAGGTAAGGTCTCTTGCCTCTCGGGCAGGCCTTGAACTCCTTGTTGTCTTC
Sequence Type genomic DNA
Unitrap ID UNI14694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30142393..30142628 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es