Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15070G12
Clone ID IST15070G12
Vector VICTR80
Project tigm

Sequence tag IST15070G12HMR1
Sequence
ACCTANCCCCTCTATTTGTTATTATTTTCTTGTTTGTTCCTGAGAGAGGATCTCAGGTGTCCTAGTCCGGCCTCAAACAC
ACTATGTAGTANTCAAGGGTGACCTTGAATTTCTGGTCCTCCTGCCTCCACCTCTGAAGTTCTGGAGTTGCAGGCCGTCC
CCACCACACCCAGTTTATGTGGTGCTCAGAATCAAGTCCAGGACACCCTGCATGCTAGCCATGGCTCCCTGCGTGCTAGC
CAGACAAACAGCCATGTGGACACCCTACACCAGCACGTGGCACTGGTATTGCTGGTGACCCTCTGCAGGCTCCCTTTAGG
ACATCATCCATACTTGTCTGGTGCCNAGAGCGAGTGAGCCTGCATAAGGGACATTTCCATCCTTTTCTGTGACATGGGGG
TGGAGAGCTTGACTGTTGGAGCTGTGAATTGTGTTNAATCGGANCCNATCAGAAGCTGCTTCAGTTAGCAAAGANTCCTC
GGCAGCTGGCAGCCNGGTGANANACTTGACAGTGCTGANTGCTGNANGTATAANAATGTGTGTCNATCACCCCC
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121219318..121219871 520
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST15070G12BBF1
Sequence
GGTGTTTCAGCTCTGACTGCCAATCCTGATGACTGGGCTCCATGCCCACATGGTGGAAAGAGAAAACTTCCTTTGCCAAG
CTGAACTACACACAGGCGTACACATGTATATACATACGTGTACACACACACACACACACACACACACACACACACACTAT
AAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121219156..121219320 159
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es