Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14665C2
Clone ID IST14665C2
Vector VICTR74
Project tigm

Sequence tag IST14665C2HMF1
Sequence
TTCATCCCACATGCTGGGCTCTAGCTCAGTGTTGCTATTACAGCAACCCAGTCTAAGACACTGTGCTCATTAAATTCTGT
ATTTGCATACACTTACATTTTCCAATTATAAAAAACAGATCCTACAATTAGCTTAAAGCACTACCTATTGTTCGGTTCCC
AAACAAGCTTTCTGCTTTCACTGCAAGAATCCTCCCCACGGCACAATTAGGTGTGGCCGCCTTCCTCTTACTGGCAGCAT
TCCGGAAAGTGCTCGTTCCAAACAGANTCATTGAAAATCGATATTTAGAGGAGTTAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56869416..56869714 297
 
EST/CDNA Est Name
  CJ062365.1 - BB861699.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516.1 - BY019096.1 - BY300501.1 - CJ055526.1 - BY016871.1 - CJ137696.1 - BY344091.1 - BY148848.1 - CJ071032.1


Sequence tag IST14665C2HMR1
Sequence
TGACTTATTCNAACCTCAGACCCACAGATGAACAATAAACCGTANAGTCCTTAAACAACAAGCATTTATTTTGGCACAGT
CTGGTAGATGGGTGGTCTAATACCAAAGTGCCCAGTGCTAAGTGTTTAATGAGACCACCTGCTTCCTAGACTAGACTGAT
GTCTTCCTCTTGTCCTGATATGATACATGGAGCAGGGGCCCTTTGCTTTCTCTTCGAAGGGTGCTAAATCCTACTCTTGG
GAGCTGAGTTCATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56869161..56869418 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST14665C2BBF1
Sequence
CATCCCACATGCTGGGCTCTAGCTCAGTGTTGCTATTACAGCAACCCAGTCTAAGACACTGTGCTCATTAAATTCTGTAT
TTGCATACACTTACATTTTCCAATTATAAAAAACAGATCCTACAATTAGCTTAAAGCACTACCTATTGTTCGGTTCCCAA
ACAAGCTTTCTGCTTTCACTGCAAGAATCCTCCCCACGGCACAATTAGGTGTGGCCGCCTTCCTCTTANNNNNNNNNNNN
NNNNNNNTGCTCGTTCCAAACAGAGTCATTGAAAATCGATATTTANAGGAGTTAAGTCGACCAATTCATAAAAATCCTTA
TTCNAATATCTACTTAAGTCCTAACATTTTCAAACTTTNNNAAGTCANCCTCANGGCTGGGTGGCTGAGGGCANNNGGCT
GTTCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56869417..56869823 228
 
EST/CDNA Est Name
  CJ071032.1

 
Come back to gene CJ071032.1


For any suggestions or comments, please send an email to unitrap@crg.es