Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14329G11
Clone ID IST14329G11
Vector VICTR74
Project tigm

Sequence tag IST14329G11HMR1
Sequence
CTCCAAGACAGCCNTACTCTTCTCTCCCTCTTCTCCCCTCCCCCCTCTGCCTTTGTAGACCAGGCTGGCCTGGAACTCAC
ACCTGCCTCTGCCTCTGANTGCTGGGAATAAAGGCCTGCGCCACCAATGCCTGGCANCTATACTAATTTTTACACCTANT
TAGGGAGACCACACAGGGATAACTGTGGGCCAGCCATGCANCAGTGCTGATGGTGACCTAACTTGGGATTTTTGGCCTCT
ACATTANCTGGTATAGGCATTANNCNCCNTGGCN
Sequence Type genomic DNA
Unitrap ID UNI909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21261210..21261482 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]


Sequence tag IST14329G11HMF1
Sequence
GAGCCATGCACATCTTCTCAGACATGTGGCCCAGGTTACAAGCTACCACAGAGATAGACTTGAACCTGAACAGGCAAAGC
TGATCTTTTGTGATAGGAATCAGGGCAAAGGCTTTTCCTTGGAGGAACAGGCAGGAAGACACACAACTGAACTTTCTTGG
GAGGCAAAAATTAGCCTCAATGCTGATCTGTACGGTGATCAGCAGTTTTTGTTTTGTTTTGATTTAAAGTTATCAGAACA
ATCAGGGTGTGTATTTACGATGCATACTTAATTGTGTCTCTCAAGAAAGGTCACTAGCAGGGCATAGGAGATAGGAGGGT
CAAAAAGTTCATTACTGCCGGGGCGTGGTGGTGCATGCCTTTAATCCCAGTACTCGGGAGGCAGANGCAGGCGGATTTCT
GAGTTCTNNGCCAGCCTGGTCTACAAAGGGCTACACAGAGANNCCCTGTGNGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21260752..21261212 449
NO GENE  

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es