Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14624B7
Clone ID IST14624B7
Vector VICTR74
Project tigm

Sequence tag IST14624B7HMF1
Sequence
NCNNNANNNNTACTNNNNTNGACACCNTNNCCTACACCCTCATCTANACACACAAAGACCAAAGGCTGCTGAGGATCANC
CTGTCTTCANAGGGTCCACGCANTTGAANAANACTGATAATATTCCTCATAGGGGACAATTAACACTAGTAATGGTTGCT
GGCTCACAGGCAGCCACATCACCACACCTCAGGGATAGCTTCTCCTCAGAGTCCTGGCCCCTGCCATCTAGATACACAAT
ACTAACCTACTCAGATAAGAGCCCTTGAAGACCTCTCTCTAGGCAAAGAAGCCAATATGGGTCCTGAAGGCCCATGTCCC
CACCACATGCACTCATCCCTCTGGTTGGTAAAGTGAAGATCCACTAGAAATACACTTTAGTCCCATGCTGAGCTATCCTA
CCTGCCTGCCTTCTCAGCCTTCTGTGCAGACAGGGCCCCTCCACCCAGATGAATACACCACATCAGANCCTCAGCCNCCA
CAGCCTANGCAGCCACCATTTCTTCTTANTTTCAATAGCTTCNANGTTCCCTGCCTANGAAGCCNCTTNAGCTNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181325927..181326462 498
 
EST/CDNA Est Name
  CN660528.1 - BB613315.1 - BY730672.1 - CJ119553.1 - CJ109349.1 - CJ064878.1


Sequence tag IST14624B7HMR1
Sequence
TTGGCTCTTTCTACACTTCTNATGTCTTCTGGGTTATTTANAAAGACCTTGTCTGGGCAAACCCCCTTCTCTAAGTTAGA
AGCTTCCATTACTTGCTTTTTGATGTGATCAATATAGGAGGTCAGGGCTAGAGAGACATATTGAGGGCCTCTAGGATAGC
CCCAGTGAAAGTCCTGGGTTGANCCTGTTCGTCTCATANGTCTGTGTACTTACTCTGCANANATGACTGAATCCTTTTGT
GTTGGAGGANGCCGTCNGCTTCN
Sequence Type genomic DNA
Unitrap ID UNI29740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181325649..181325910 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000823 (Znf512b) zinc finger protein 512B Gene [Source:MGI (curated);Acc:Znf512b-001]

 
Come back to gene ENSMUSG00000000823


For any suggestions or comments, please send an email to unitrap@crg.es