Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_272D8-3
Clone ID CMHD-GT_272D8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_272D8-3
Sequence
ATGTTGATGCCTAAGAAGAATCGGATTGCCATCTACATAACTCCTTTTTAGAGGAGGGCGTGATGGTCGCCAAAAAGGAT
GTCCACCTGCCTAAGCACCCGGAGCTGGCACACAAAAATGTGCCCAACCTTCATGGAATGAAGGCCATGCAGTCTCTCAG
GTCTCGAGGCTACGTGAAGGAACAGTTTGCTTGGAGACATTTCTACTGGTACCTTACGAACGAGGGCATCCAGTATCTCC
AAGACTACCTGCACCTACCCCCGGAGATCGTGCCCGCCACCCTGCGTCGCAGCCGTCCCGAGACCGGCAGGCCTCGGCCC
AAAGGTCCAGAGGGTGAGCGACCTGCAAGATTCACAAGAGGGGAGGCTGACAGAGACACCTACAGAAGGAGCGCTGTGCC
CCCTGGAGCTGACAAGAAAGCTGAGGCTGGGGCTGGCTCAGCCACTGAGTTCCAGTTTAGAGGCGGCTTTGGTCGTGGAC
GTGGTCAGCCACCTCAGTGAAGTTGGAGTTTATGTTGTATTGAATAAACTTTAAAGAAAAACT
Sequence Type mRNA
Unitrap ID UNI8477

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27767368..27771420 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]

 
Come back to gene ENSMUSG00000052146


For any suggestions or comments, please send an email to unitrap@crg.es