Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10267C9
Clone ID IST10267C9
Vector VICTR76
Project tigm

Sequence tag IST10267C9BBF1
Sequence
CTTATNATCGTTGCTTAGGAGGTGGGGAGACTTCTATCCGACCGACCCAAGTCCTGTACTCAAAACCTCTTANAGTCATA
AAAGGAAGCAGGTAAAAGAGTTAACAGTGCCATTGCCCACTCGGTGTGACCTTGGCCAGGCCCCATCGTCTTGGAAATGG
GGTAAGGGAAGAGGAGGCTACTTTGAAAGAT
Sequence Type genomic DNA
Unitrap ID UNI31190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3842628..3842817 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082848 (AC133523.2)  


Sequence tag IST10267C9HMF1
Sequence
CTTATNATCGTTGCTTAGGAGGTGGGGAGACTTCTATCCGACCGACCCAAGTCCTGTACTCAAAACCTCTTANAGTCATA
AAAGGAAGCAGGTAAAAGAGTTAACGCCATC
Sequence Type genomic DNA
Unitrap ID UNI31190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3842713..3842817 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082848 (AC133523.2)  

 
Come back to gene ENSMUSG00000082848


For any suggestions or comments, please send an email to unitrap@crg.es