Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14646H3
Clone ID IST14646H3
Vector VICTR74
Project tigm

Sequence tag IST14646H3BBF1
Sequence
CTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTC
Sequence Type genomic DNA
Unitrap ID UNI31261 UNI31263 UNI31264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 18381391..18381445 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79044708..79044762 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020317 (Theg) NM_199226 testicular haploid expressed gene Gene [Source:MGI Symbol;Acc:MGI:1338756]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68243184..68243238 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7806768..7806822 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18561828..18561882 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 17917597..17917651 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 7168727..7168781 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042961 (Egflam) NM_178748 EGF-like, fibronectin type III and laminin G domains Gene [Source:MGI Symbol;Acc:MGI:2146149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17497405..17497459 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4198979..4199033 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3799421..3799475 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 15248620..15248674 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7616411..7616465 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 20000227..20000281 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002428 (Hltf) NM_009210 helicase-like transcription factor Gene [Source:MGI Symbol;Acc:MGI:1196437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4661286..4661340 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4476538..4476592 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19829121..19829175 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 37952103..37952157 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5004484..5004538 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 41409933..41409987 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 683147..683201 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39405647..39405701 55
NO GENE  


Sequence tag IST14646H3HMR1
Sequence
GGAAGGAAGGATTTTCAGACATATGATTCTTCTAGTACTATTGACTATCGAATTTTGATCATGAAGGCACATTGGATTTT
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3006312..3006379 66
NO GENE  


Sequence tag IST14646H3HMF2
Sequence
CTTCCTTCCTTTCTTTCTTTCTTTCTTTNTTTCTTTCTTTCTTTCTTTCTTTCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 683147..683201 53
NO GENE  

 
Come back to gene ENSMUSG00000002428


For any suggestions or comments, please send an email to unitrap@crg.es