Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_269D5-3
Clone ID CMHD-GT_269D5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_269D5-3
Sequence
CTGATGCAGCTGTACAGCGCCCGCCGGAGGAGGCGCCTGAACCGTGGTCTTCGGCGGAAGCAACACTCACTGCTCAAGCG
CTTGAGAAAGGCCAAAAAGGAGGCACCACCCATGGAGAAGCCTGAGGTGGTGAAGACGCACCTGAGGGACATGATCATCC
TGCCGGAGATGGTGGGTAGCATGGTGGGCGTGTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAACCAGAGATGATC
GGCCACTACCTGGGCGAGTTCTCCATCACCTACAAACCCGTGAAGCACGGCCGGCCCGGGATCGGTGCCACCCACTCCTC
CCGATTCATCCCCCTCAAGTAGCCGAGGCCAATAAAGACTGGTTTTGGTCCCTG
Sequence Type mRNA
Unitrap ID UNI6174

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79756394..79756857 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063457 (Rps15) NM_009091 ribosomal protein S15 Gene [Source:MGI (curated);Acc:Rps15-001]

 
Come back to gene ENSMUSG00000063457


For any suggestions or comments, please send an email to unitrap@crg.es